Differences between revisions 51 and 166 (spanning 115 versions)
Revision 51 as of 2005-10-20 11:46:17
Size: 1015
Editor: 211
Comment:
Revision 166 as of 2013-08-13 19:27:35
Size: 4289
Editor: 61
Comment:
Deletions are marked like this. Additions are marked like this.
Line 1: Line 1:
#acl Known:admin,read,write,delete,revert All:read
약간의 테스트 -- yong27 [[Da
teTime(2005-07-02T12:13:53Z)]]
#acl Known:admin,read,write,delete,revert,admin All:read,write
Line 4: Line 3:
약간더 테스트.. -- ["cyppi"] [[DateTime(2005-08-24T02:00:19Z)]] homepage.mac.com 이 뭐하는 사이트더냐
Line 6: Line 5:
제대로 좀 돼라.. -- ["terra19"] [[DateTime(2005-08-24T02:09:58Z)]] ||<rowbgcolor="yellow">으하||
Line 8: Line 7:
drawing:test {{{#!dot
digraph G {
    1 -> 3
    1 -> 4
    2 -> 4
    3 -> 5
    4 -> 5
    1 -> 6
    4 -> 6
    5 -> 7
    6 -> 7
}
}}}
Line 10: Line 21:
{{{#!latex
x^2 + y^2 = r^2
{{{#!dot
digraph G {
    node [style=filled, fillcolor=white, overlap=false, fontname="Eunjin", fontsize="11"]
    Proteome -> Project -> 한글
    Project -> Proteome -> 한글
    Species -> Individual -> 한글
    Proteome -> Spot
    Spot -> Mascot
    Spot -> Protein
    Protein -> Spot

    User -> Proteome
    User -> Project
    User -> Protein

    User -> DNA
    Individual -> Proteome
    Organ -> Proteome
    PhysiologicalStatus -> Proteome
    DifferentiatedStatus -> Proteome
    Attribute -> Proteome
    IEF -> Proteome
    Proteome [fillcolor=yellow]
    Project [fillcolor=yellow]
    Spot [fillcolor=yellow]
    Protein [fillcolor=yellow]
}
}}}



{{{#!latex
$$ x^2 + y^2 +1-c = r^2 +1 +1 + 5 +666 $$
Line 20: Line 62:
'''__[[Color(blue:Hello World!)]] or [[Color(#8844aa:Hello World!)]]__''' '''__<<Color(blue:Hello World!)>> or <<Color(#8844aa:Hello World!)>>__'''

{{| box table

paragraph |}}
Line 23: Line 69:
Query: aggtgcctgtaggtgatcaacctaaagatattgagcttcaaatcagagagctcatccttcggttcatcagtaatccaaattccattatcctcgctgtcactgctgctaatacagatatgggcacatcagaggcacttaaaatttcaagagaggtagatccagatggt
Match: ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: aggtgcctgtaggtgatcaacctaaggatattgagcttcaaatcagagagctcattcttcggttcatcagtaatcctaattccattatcctcgctgtcactgctgctaatacagatatggcaacatcagaggcacttaaaatttcaagagaggtagatccagatggt
pre
tag
Line 27: Line 72:

{{{
#!html
<script language="javascript">

function ques1Click(answer)
{
        var ques1 = document.getElementsByName("ques1");
        var account1 = document.getElementById("account1");
        if(answer == 'school')
        {
                account1.style.display="block";
        }
        return false;
}

</script>
<HTML>
<table>
        <tr>
                <td>문제1. 위의 사진에 나온 마네키네꼬는 무엇을 상징할까요?</td>
        </tr>
        <tr>
                <td name>
                        <INPUT TYPE="radio" name="ques1" value="school" onClick="javaScript:ques1Click('school');">명문교 진학<BR>
                        <INPUT type=radio name="ques1" value="sales" onClick="javaScript:ques1Click('sales');">상업 번성<BR>
                        <INPUT type=radio name="ques1" value="health" onClick="javaScript:ques1Click('health');">무병 장수<BR>
                </td>
        </tr>
        <tr>
        <td>
                <div id="account1" style="display:none">
            일본의 엔키모노들 가운데에서도 오늘날까지 생명력을 잃지 않고 <br>
            가장 널리 퍼져 있으며, 전통적인 상징의 티를 벗고 동시대인들의 <br>
            마음을 담아내는 데 성공한 것이 바로 마네키네코다.<br>
                </div>
        </td>
    </tr>
</table>

}}}

박스안에서 코드박스를 또 만들 수 있을까?

{{| 이것은 테스트용 박스

박스안은 멀티라인

{{{
python asdf.py
}}}

|}}

어떤 테스트

 * 뭐냐면
 * 글쎄다



{{|
이것은 박스입니다
|}}


{{{#!gnuplot
plot sin(x)
}}}


{{{#!python
import unittest

class SomeTest(unittest.TestCase):
    def test1(self):
        pass

if __name__=='__main__':
    unittest.main()
}}}

<<Numbering>>, <<Numbering>>


<<Numbering>>

<<PageCount>>

{{drawing:test}}


\[Test\]

{{{#!html
<a href="http://www.flickr.com/photos/yong27/2099410433/" title="brothers family by yong27, on Flickr"><img src="http://farm3.static.flickr.com/2386/2099410433_5632c9b6e4.jpg" width="500" height="375" alt="brothers family" /></a>
}}}


{{{#!html
<object width="400" height="300"> <param name="flashvars" value="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fyong27%2Ftags%2Fme%2Fshow%2F&page_show_back_url=%2Fphotos%2Fyong27%2Ftags%2Fme%2F&user_id=90128522@N00&tags=me&jump_to=&start_index="></param> <param name="movie" value="http://www.flickr.com/apps/slideshow/show.swf?v=71649"></param> <param name="allowFullScreen" value="true"></param><embed type="application/x-shockwave-flash" src="http://www.flickr.com/apps/slideshow/show.swf?v=71649" allowFullScreen="true" flashvars="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fyong27%2Ftags%2Fme%2Fshow%2F&page_show_back_url=%2Fphotos%2Fyong27%2Ftags%2Fme%2F&user_id=90128522@N00&tags=me&jump_to=&start_index=" width="400" height="300"></embed></object>
}}}

homepage.mac.com 이 뭐하는 사이트더냐

으하

$$ x^2 + y^2 +1-c = r^2 +1 +1 + 5 +666 $$

[바뀐글], [글찾기], [도움말], [사용자설정]

{X} {i}

{ko}

Hello World! or Hello World!

{{| box table

paragraph |}}

pre
tag

문제1. 위의 사진에 나온 마네키네꼬는 무엇을 상징할까요?
명문교 진학
상업 번성
무병 장수

박스안에서 코드박스를 또 만들 수 있을까?

{{| 이것은 테스트용 박스

박스안은 멀티라인

python asdf.py

|}}

어떤 테스트

  • 뭐냐면
  • 글쎄다

{{| 이것은 박스입니다 |}}

plot sin(x)

   1 import unittest
   2 
   3 class SomeTest(unittest.TestCase):
   4     def test1(self):
   5         pass
   6 
   7 if __name__=='__main__':
   8     unittest.main()

1, 2

3

23517

\[Test\]

brothers family

TestPage (last edited 2013-08-17 12:33:26 by 31)